View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17513_high_14 (Length: 237)
Name: NF17513_high_14
Description: NF17513
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17513_high_14 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 106; Significance: 4e-53; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 106; E-Value: 4e-53
Query Start/End: Original strand, 94 - 220
Target Start/End: Complemental strand, 427861 - 427735
Alignment:
| Q |
94 |
aactagttgaaacccttaatgaagaaagatcaattgacattttctaatgnnnnnnncaaccaaagaatatagctgaaataaaaaccgctgacaataatgt |
193 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
427861 |
aactagttgaaacccttaatgaagaaagatcaattgacattttctaatgaaaaaaacaaccaaagaatatagctgaaataaaaaccgctgacaataatgt |
427762 |
T |
|
| Q |
194 |
actaaatcattatcatatagccaaagt |
220 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
427761 |
actaaatcattatcatatagccaaagt |
427735 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 1 - 65
Target Start/End: Complemental strand, 427932 - 427868
Alignment:
| Q |
1 |
ttgtgtgttatctatgttgcgttaacaatttgtttttgtgctttctttataattagaatataaga |
65 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
427932 |
ttgtgtgttatctatgttgcgttaacaatttgtttttgtgctttctttataattagaatataaga |
427868 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University