View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17513_high_3 (Length: 482)
Name: NF17513_high_3
Description: NF17513
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17513_high_3 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 379; Significance: 0; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 379; E-Value: 0
Query Start/End: Original strand, 19 - 475
Target Start/End: Original strand, 50082103 - 50082548
Alignment:
| Q |
19 |
cttggattatattaattggtaaattatcgtagctagatcactagttccacaaaaggaaaaatgataaaataatgtctaacccaccaaaacggcattaatg |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50082103 |
cttggattatattaattggtaaattatcgtagctagatcactagttccacaaaaggaaaaaggataaaataatgtctaacccaccaaaacggcattaatg |
50082202 |
T |
|
| Q |
119 |
tagatgaggcacaaacataacattatttggatggtctttggtttgtattggtgatgatgccctgtagtctcagactcagactcagactcagacctgccaa |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||| ||||||| |
|
|
| T |
50082203 |
tagatgaggcacaaacataacattatttggatggtctttgctttgtattggtgatgatgccctgtagcctcagactcagac------------ctgccaa |
50082290 |
T |
|
| Q |
219 |
ttcatacacataattgcgtcagtcacattctagaactaacaaaattgtattaatttcagtcatatttgttttggcttccttctacttttgtttgccgacc |
318 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50082291 |
ttcatacccataattgcgtcagtcacattctagaactaacaaagttgtattaatttcagtcatatttgttttggcttccttctacttttgtttgccgacc |
50082390 |
T |
|
| Q |
319 |
taattactagtctt--ggccatctttttattaatcttgataagtttggtagacaggtccaggctttcaacttcactttcaccatatctctaaaataatgt |
416 |
Q |
| |
|
|||||||||||||| |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50082391 |
taattactagtcttttggccatcttttt-ttaatcttgataagtttggtagacaggtccaggctttcaacttcactttcaccatatctctaaaataatgt |
50082489 |
T |
|
| Q |
417 |
ctcatttccatacatataataatatatactattatttaacatacccacattttcttatc |
475 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50082490 |
ctcatttccatacatataataatatatactattatttaacatacccacattttcttatc |
50082548 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University