View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17514_high_11 (Length: 330)
Name: NF17514_high_11
Description: NF17514
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17514_high_11 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 68; Significance: 2e-30; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 67 - 175
Target Start/End: Complemental strand, 13362186 - 13362076
Alignment:
| Q |
67 |
atttctcaaacatttttattgaaatcatggatccaattccctttggnnnnnnnn--tgagaaacaaaatccagcaaagcagagaatataaatgtttatag |
164 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
13362186 |
atttttcaaacatttttattgaaatcatggatccaattccctttggaaaaaaaaaatgagaaacaaaatccagcaaagtagagaatataaatgtttatag |
13362087 |
T |
|
| Q |
165 |
atctgggtttg |
175 |
Q |
| |
|
||||||||||| |
|
|
| T |
13362086 |
atctgggtttg |
13362076 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 1 - 80
Target Start/End: Complemental strand, 13362308 - 13362227
Alignment:
| Q |
1 |
acaacaataacattcaccgtaacacgaagcttgttcctcaatatccattc--atgcccatgactctaaatttctcaaacatt |
80 |
Q |
| |
|
|||||||||||||||||| ||||| ||||||||||||||||||||||||| || |||||||||| |||||||||||||||| |
|
|
| T |
13362308 |
acaacaataacattcaccataacatgaagcttgttcctcaatatccattcatatacccatgactccaaatttctcaaacatt |
13362227 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 232 - 270
Target Start/End: Complemental strand, 13362019 - 13361981
Alignment:
| Q |
232 |
ggtttttgttctctttaatgcttatggaattgctttgct |
270 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13362019 |
ggtttttgttctctttaatgcttatggaattgctttgct |
13361981 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 53; Significance: 2e-21; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 67 - 175
Target Start/End: Complemental strand, 50056684 - 50056571
Alignment:
| Q |
67 |
atttctcaaacatttttattgaaatcatggatccaattccctttgg-nnnnnnnntgagaaacaaaatccagcaaagcagagaat----ataaatgttta |
161 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||| ||| ||||||| |
|
|
| T |
50056684 |
atttgtcaaacatttttattgaaatcatggatccaattccctttggaaacaaagatgagaaacaaaatccaggaaagcagagaatatacatacatgttta |
50056585 |
T |
|
| Q |
162 |
tagatctgggtttg |
175 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
50056584 |
tagatctgggtttg |
50056571 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 1 - 80
Target Start/End: Complemental strand, 50056804 - 50056725
Alignment:
| Q |
1 |
acaacaataacattcaccgtaacacgaagcttgttcctcaatatccattcatgcccatgactctaaatttctcaaacatt |
80 |
Q |
| |
|
|||||||||||||||||| |||| ||||| ||||||||||||||||||||| || ||||||| |||||||||||||||| |
|
|
| T |
50056804 |
acaacaataacattcaccataacttgaagcctgttcctcaatatccattcatacctatgactccaaatttctcaaacatt |
50056725 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 232 - 270
Target Start/End: Complemental strand, 50056513 - 50056475
Alignment:
| Q |
232 |
ggtttttgttctctttaatgcttatggaattgctttgct |
270 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
50056513 |
ggtttttattctctttaatgcttatggaattgctttgct |
50056475 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University