View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17515_high_27 (Length: 276)
Name: NF17515_high_27
Description: NF17515
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17515_high_27 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 130; Significance: 2e-67; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 130; E-Value: 2e-67
Query Start/End: Original strand, 127 - 256
Target Start/End: Complemental strand, 1233170 - 1233041
Alignment:
| Q |
127 |
gtctcaattttaaagtccaagactctagctggatttgcttttcccttggactcactctgaatataattttttagaactaaaccagtctggtgaaccctct |
226 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1233170 |
gtctcaattttaaagtccaagactctagctggatttgcttttcccttggactcactctgaatataattttttagaactaaaccagtctggtgaaccctct |
1233071 |
T |
|
| Q |
227 |
aaattgtcatttgtgtgtttttctttgctg |
256 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
1233070 |
aaattgtcatttgtgtgtttttctttgctg |
1233041 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 86; E-Value: 4e-41
Query Start/End: Original strand, 13 - 102
Target Start/End: Complemental strand, 1233283 - 1233194
Alignment:
| Q |
13 |
tgaagggattatatttactaaatgagttgatgaacatctatacctagaaaacactatttcgttgaattagatatttatagataaaatgag |
102 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1233283 |
tgaagggattatatttactatatgagttgatgaacatctatacctagaaaacactatttcgttgaattagatatttatagataaaatgag |
1233194 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University