View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17515_high_31 (Length: 252)
Name: NF17515_high_31
Description: NF17515
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17515_high_31 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 85; Significance: 1e-40; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 85; E-Value: 1e-40
Query Start/End: Original strand, 16 - 132
Target Start/End: Original strand, 32006200 - 32006316
Alignment:
| Q |
16 |
tgtgcattggcaaaggccggtccctggtcaactcaagtgtaatatagatgcagctttttgtggtctttaaatcttataggaattggcatatgtgtacgag |
115 |
Q |
| |
|
|||||||||||||||| ||| ||||| ||| ||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
32006200 |
tgtgcattggcaaaggtcggcccctgatcagctcaagtgtaatatagatgcagcttttcgtggtctttaaattgtataggaattggcatatgtgtacgag |
32006299 |
T |
 |
| Q |
116 |
ataatgaaggaactttt |
132 |
Q |
| |
|
|| |||||||||||||| |
|
|
| T |
32006300 |
atgatgaaggaactttt |
32006316 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 18 - 66
Target Start/End: Complemental strand, 49731367 - 49731319
Alignment:
| Q |
18 |
tgcattggcaaaggccggtccctggtcaactcaagtgtaatatagatgc |
66 |
Q |
| |
|
|||||||||||||| || ||||||||| |||||||||||||||||||| |
|
|
| T |
49731367 |
tgcattggcaaaggtcgatccctggtcgtctcaagtgtaatatagatgc |
49731319 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University