View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17515_high_36 (Length: 231)
Name: NF17515_high_36
Description: NF17515
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17515_high_36 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 121; Significance: 4e-62; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 121; E-Value: 4e-62
Query Start/End: Original strand, 90 - 214
Target Start/End: Complemental strand, 10435554 - 10435430
Alignment:
| Q |
90 |
tgcatgtacatgcgcacgcgtgcgcgtttcattcaatagataagaactgagtttaacttttaagtcaacttttataagttttggatgagattcttctaat |
189 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10435554 |
tgcatgtacatgcgcacgcgtgcgcgtttcattcaatagataagaactaagtttaacttttaagtcaacttttataagttttggatgagattcttctaat |
10435455 |
T |
 |
| Q |
190 |
ttaaagttgaacttatgcaactaaa |
214 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
10435454 |
ttaaagttgaacttatgcaactaaa |
10435430 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 19 - 88
Target Start/End: Complemental strand, 10435686 - 10435617
Alignment:
| Q |
19 |
atgttgtcatacccaactcaacatcatcaccaatattacctttggtatgtctcatttatgcagctcatat |
88 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10435686 |
atgttgtcatacccaactcaacatcatcaccaatattacctttggtatgtctcatttatgcagctcatat |
10435617 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University