View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17515_low_11 (Length: 452)
Name: NF17515_low_11
Description: NF17515
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17515_low_11 |
 | |
|
| [»] scaffold0284 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0284 (Bit Score: 365; Significance: 0; HSPs: 1)
Name: scaffold0284
Description:
Target: scaffold0284; HSP #1
Raw Score: 365; E-Value: 0
Query Start/End: Original strand, 20 - 424
Target Start/End: Original strand, 5548 - 5952
Alignment:
| Q |
20 |
atcttccgttcaagtatttgagattacggtgggggcaaatcctggaaaagtggcaatgtgggaacctttattagaacacttgactatgaggttgaatacg |
119 |
Q |
| |
|
|||||||||||||||||||||| |||| |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5548 |
atcttccgttcaagtatttgaggctacgatgggggcaaatcctggaagagtggcaatgtgggaacctttattagaacacttgactatgaggttgaatacg |
5647 |
T |
|
| Q |
120 |
tggggtaacaagtataatagcctttggtggcggaattgtgcttctaaattcggttttgaattccatctctatattttatttatccttttctagaatgtct |
219 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5648 |
tggggtaacaagtataatagcctttggtggccgaattgtgcttctaaattcggttttgaattccatctctatattttatttatccttttctagaatgtct |
5747 |
T |
|
| Q |
220 |
ggtttagtttggaggaagatagagaaaatctaaacatgttactggcatttcaatgtagatgcatgtgattatgttctaaccactagagaggatatcctag |
319 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5748 |
ggtttagtttggaggaagatagagaaaatctaaacatgttactggcagttcaatgtagatgcatgtgattatgttctaaccactagagaggatatcctag |
5847 |
T |
|
| Q |
320 |
tcaagttgcgcaagatccttctttaggcgcaaactgctatgaagcttgcaattgataaatattgtcgtgaggtgcagtttttagacaaaatatgggtgta |
419 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
5848 |
tcaagttgcgcaagatccttcttaaggcgcaaactgctatgaagcttgcagttgataaacattgtcgtgaggtgcagtttttagacaatatatgggtgta |
5947 |
T |
|
| Q |
420 |
tgtta |
424 |
Q |
| |
|
||||| |
|
|
| T |
5948 |
tgtta |
5952 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 39; Significance: 0.0000000000007; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 382 - 424
Target Start/End: Original strand, 9489080 - 9489122
Alignment:
| Q |
382 |
tgtcgtgaggtgcagtttttagacaaaatatgggtgtatgtta |
424 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
9489080 |
tgtcgtgaggtgcagtttttagacaatatatgggtgtatgtta |
9489122 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 154 - 198
Target Start/End: Original strand, 29081930 - 29081974
Alignment:
| Q |
154 |
attgtgcttctaaattcggttttgaattccatctctatattttat |
198 |
Q |
| |
|
||||||||||||||||||||||||||||| ||| | ||||||||| |
|
|
| T |
29081930 |
attgtgcttctaaattcggttttgaattctatcccgatattttat |
29081974 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University