View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17515_low_15 (Length: 437)
Name: NF17515_low_15
Description: NF17515
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17515_low_15 |
 |  |
|
| [»] scaffold0428 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr6 (Bit Score: 74; Significance: 8e-34; HSPs: 5)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 74; E-Value: 8e-34
Query Start/End: Original strand, 288 - 401
Target Start/End: Original strand, 8295894 - 8296006
Alignment:
| Q |
288 |
tattttaagaactttgtgacatgtgatgtaagctcttgcgtatgttattctttctagaaggaaaaatctttatctagtatctggtcatatgaacttaaat |
387 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| | |||||| ||| |||||||||||||| ||| |
|
|
| T |
8295894 |
tattttaagaactttgtgacaagtgatgtaagctcttgcgtatgttattctttctagaaggaaaaaacactatctaatattcggtcatatgaactt-aat |
8295992 |
T |
 |
| Q |
388 |
gtactgtaaaagtt |
401 |
Q |
| |
|
||| |||||||||| |
|
|
| T |
8295993 |
gtaatgtaaaagtt |
8296006 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 63; E-Value: 3e-27
Query Start/End: Original strand, 108 - 294
Target Start/End: Original strand, 8295676 - 8295859
Alignment:
| Q |
108 |
atttagaattcgactgaaaaatgaatgaagtctgattaaaaattgtttcaagcagaattcaaactcggatactggctaccagacaatttgtttttaaatg |
207 |
Q |
| |
|
||||||||||||| ||||| || | |||| |||||||||||||| |||||| |||||||||| ||||||||| ||| ||||||||||||||| || |
|
|
| T |
8295676 |
atttagaattcgattgaaagataagtgaaatctgattaaaaattatttcaaaaagaattcaaattcggatactt----ccaaacaatttgtttttaattg |
8295771 |
T |
 |
| Q |
208 |
tttcgtattatccattagagtgtaatagttagacaagacaa-gaatatttaagagcatagcactgcaatacctttcatgaatatttta |
294 |
Q |
| |
|
||| |||| | ||| ||| |||||| ||| ||||||||| |||| ||||| ||||||||| |||||| |||||||||||||||||| |
|
|
| T |
8295772 |
attctcattaactattggagcgtaataattatacaagacaaagaatgtttaaaagcatagcattgcaatgcctttcatgaatatttta |
8295859 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 1 - 63
Target Start/End: Original strand, 8295563 - 8295625
Alignment:
| Q |
1 |
atggatgatgaaaaacaagatatttttgtaagatggatatctccaaaagatacttttataaca |
63 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||| |||||| ||||||||||| |
|
|
| T |
8295563 |
atggatgatgaaaaacaaagtatttttgtaagatggatatctcctaaagatgcttttataaca |
8295625 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 300 - 353
Target Start/End: Complemental strand, 33255894 - 33255841
Alignment:
| Q |
300 |
tttgtgacatgtgatgtaagctcttgcgtatgttattctttctagaaggaaaaa |
353 |
Q |
| |
|
||||||||| ||||||||||||||||||||||| ||| |||||| ||||||||| |
|
|
| T |
33255894 |
tttgtgacaagtgatgtaagctcttgcgtatgtgattgtttctataaggaaaaa |
33255841 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #5
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 8 - 43
Target Start/End: Complemental strand, 33256184 - 33256149
Alignment:
| Q |
8 |
atgaaaaacaagatatttttgtaagatggatatctc |
43 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||| |
|
|
| T |
33256184 |
atgaaaaacaagatatctttgtaagatggatatctc |
33256149 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0428 (Bit Score: 32; Significance: 0.00000001; HSPs: 1)
Name: scaffold0428
Description:
Target: scaffold0428; HSP #1
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 8 - 43
Target Start/End: Complemental strand, 302 - 267
Alignment:
| Q |
8 |
atgaaaaacaagatatttttgtaagatggatatctc |
43 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||| |
|
|
| T |
302 |
atgaaaaacaagatatctttgtaagatggatatctc |
267 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University