View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17515_low_28 (Length: 289)
Name: NF17515_low_28
Description: NF17515
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17515_low_28 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 52 - 274
Target Start/End: Complemental strand, 9733337 - 9733115
Alignment:
| Q |
52 |
gtgaatggcacatcttgagtgtaatctaagggccccaggaggaagttctcaacaagaaaaaggtcaataatttgtggttggaatttcatattttattact |
151 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9733337 |
gtgaatggcacatcttgagtgtaatctaagggtcccaggaggaagttctcaacaagaaaaaggtcaataatttgtggttggaatttcatattttattact |
9733238 |
T |
 |
| Q |
152 |
ctctttggttactttcaaagttcatacacaaaagtgaaatgcttgtgnnnnnnnagcaatttttaatattgtgttgttctttgtctaattttgataaaaa |
251 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9733237 |
ctctttggttactttcaaagttcatacacaaaagtgaaatgcttgtgtttttttagcaatttttaatattgtgttgttctttgtctaattttgataaaaa |
9733138 |
T |
 |
| Q |
252 |
agatggatttgagcgaccctttt |
274 |
Q |
| |
|
| ||| ||||||||||||||||| |
|
|
| T |
9733137 |
atatgaatttgagcgaccctttt |
9733115 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University