View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17515_low_35 (Length: 250)
Name: NF17515_low_35
Description: NF17515
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17515_low_35 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 13 - 233
Target Start/End: Original strand, 13590037 - 13590257
Alignment:
| Q |
13 |
cagacaaggaaagaaaactgtttgatgagaaatttgttacaatacccgccgaaagactatatgagttggcatctgccgcaaatagtcctaagttaaggtc |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||| | ||||||||||||||||||||||||||||| ||||||| |||||||||||| |
|
|
| T |
13590037 |
cagacaaggaaagaaaactgtttgatgagaaatttgttacgatacccactgaaagactatatgagttggcatctgccgcgaatagtcttaagttaaggtc |
13590136 |
T |
 |
| Q |
113 |
attggttgagctgacatgtcgtgcaatagctcgaacactggaaagaagttcaccggaggagatatgcgacacattcaatttgcctaaagagaaattggag |
212 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13590137 |
attggttgagctcacatgtcgtgcaatagctcgaacactggaaagaagttcaccggaggagatatgcgacacattcaatttgcctaaagagaaattggag |
13590236 |
T |
 |
| Q |
213 |
ccatttataaacataacttgc |
233 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
13590237 |
ccatttataaacataacttgc |
13590257 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University