View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17515_low_39 (Length: 239)
Name: NF17515_low_39
Description: NF17515
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17515_low_39 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 222; Significance: 1e-122; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 1 - 222
Target Start/End: Original strand, 26642191 - 26642412
Alignment:
| Q |
1 |
tttgttagatggatcatgggaggcaagtgttcacggtggaccttcttgaacgatatgctgcaaagggtcatggagttatcacttgtatggctgctggaaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26642191 |
tttgttagatggatcatgggaggcaagtgttcacggtggaccttcttgaacgatatgctgcaaagggtcatggagttatcacttgtatggctgctggaaa |
26642290 |
T |
 |
| Q |
101 |
tgatgtcattgttattggaactagtagaggatgggtcattcgccatgattttggggctggtgattcacatggtaaactttcaatttttgtggttttttcc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26642291 |
tgatgtcattgttattggaactagtagaggatgggtcattcgccatgattttggggctggtgattcacatggtaaactttcaatttttgtggttttttcc |
26642390 |
T |
 |
| Q |
201 |
aatcttgctgtgtgtgagacat |
222 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
26642391 |
aatcttgctgtgtgtgagacat |
26642412 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 1 - 196
Target Start/End: Original strand, 26638558 - 26638753
Alignment:
| Q |
1 |
tttgttagatggatcatgggaggcaagtgttcacggtggaccttcttgaacgatatgctgcaaagggtcatggagttatcacttgtatggctgctggaaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26638558 |
tttgttagatggatcatgggaggcaagtgttcacggtggaccttcttgaacgatatgctgcaaagggtcatggagttatcacttgtatggctgctggaaa |
26638657 |
T |
 |
| Q |
101 |
tgatgtcattgttattggaactagtagaggatgggtcattcgccatgattttggggctggtgattcacatggtaaactttcaatttttgtggtttt |
196 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||| |
|
|
| T |
26638658 |
tgatgtcattgttattggaactagtagaggatgggtcattcgccatgattttggggctggtgattcacatggtaaacttccaatttttgtgttttt |
26638753 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University