View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17515_low_41 (Length: 231)
Name: NF17515_low_41
Description: NF17515
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17515_low_41 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 84; Significance: 5e-40; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 84; E-Value: 5e-40
Query Start/End: Original strand, 123 - 214
Target Start/End: Original strand, 30876871 - 30876962
Alignment:
| Q |
123 |
ctttggagaagatgcaggcatacatgatcagtaccaaatccatctaattgggatttgtgaagctatgcttagaaggaaatacccaataaaat |
214 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30876871 |
ctttggagaagatgcaggcatacatggtcagtaccaaatccatctaattgggacttgtgaagctatgcttagaaggaaatacccaataaaat |
30876962 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 13 - 83
Target Start/End: Original strand, 30876711 - 30876781
Alignment:
| Q |
13 |
ttatactccaaattttcaagctcccaacacttcttcaatacaagatgagatggataatggaaaatgctaat |
83 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30876711 |
ttatactccaaattttcaagctcccaacacttcttcaatacaagatgagatggataatggaaaatgctaat |
30876781 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 73 - 115
Target Start/End: Complemental strand, 30876823 - 30876781
Alignment:
| Q |
73 |
aaaatgctaatgaattttaattgctcaagaaatatgtcttcaa |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30876823 |
aaaatgctaatgaattttaattgctcaagaaatatgtcttcaa |
30876781 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University