View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17515_low_44 (Length: 221)

Name: NF17515_low_44
Description: NF17515
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17515_low_44
NF17515_low_44
[»] chr1 (1 HSPs)
chr1 (16-204)||(6232241-6232429)


Alignment Details
Target: chr1 (Bit Score: 169; Significance: 8e-91; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 169; E-Value: 8e-91
Query Start/End: Original strand, 16 - 204
Target Start/End: Complemental strand, 6232429 - 6232241
Alignment:
16 aatatacaaggagtaaactaagtataaaataaataaccttttttgcttcatgtaactgcaagccaccaaagtgcaatgaataccataattgagctgtaaa 115  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||    
6232429 aatatacaaggagtaaactaagtataaaataaataaccttttttgcttcatgtaactgcaagccaccaaagtgcaatgaataccataatggagctgtaaa 6232330  T
116 tgagaaagcacttaactgtttgcaagtatatttattgaagaaatctcttcttgtgctgccataccaaaaactaccttctatgaattgga 204  Q
    |||||||||||||||||||||||||||||||||||||||||   ||||||||||| |||||||||||||||||||||||||||||||||    
6232329 tgagaaagcacttaactgtttgcaagtatatttattgaagaggcctcttcttgtgttgccataccaaaaactaccttctatgaattgga 6232241  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University