View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17516_high_12 (Length: 388)
Name: NF17516_high_12
Description: NF17516
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17516_high_12 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 324; Significance: 0; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 324; E-Value: 0
Query Start/End: Original strand, 23 - 358
Target Start/End: Original strand, 28122347 - 28122682
Alignment:
| Q |
23 |
tgccggtcacctatgatatgtctacacttttcgactcaatgggacaaccttcattctccatgcaacaacagaggtccagtattgatccacgtcaatactt |
122 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28122347 |
tgccggtcacctatgatatgtctacacttttcgactcaatgggacaaccttcattctccatgcaacaacagaggtccagtattgatccacgtcaatactt |
28122446 |
T |
 |
| Q |
123 |
agctgctcatcatcatgccccaacatcaaccacttctgggattcaatcagtggcatgtgaccttactcatagacaaattggctcttcatctgtaccatcc |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28122447 |
agctgctcatcatcatgccccaacatcaaccactgctgggattcaatcagtggcatgtgaccttactcatagacaaattggctcttcatctgtaccatcc |
28122546 |
T |
 |
| Q |
223 |
tccaatgcctcatcatctgcttcgttttccaaattttctaaatgatcagtcatgttttgaatataatacattaatatattctgttgtctgttacaaaaat |
322 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
28122547 |
tccaatgcctcatcatctgcttcgttttccaaattttctaaatgatcattcatgttttgaatataatacattaatatattctgttgtctattacaaaaat |
28122646 |
T |
 |
| Q |
323 |
ctgtctttcttttttcatccttcggccagacatggg |
358 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
28122647 |
ctgtctttcttttttcatccttcggccagacatggg |
28122682 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University