View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17516_high_25 (Length: 284)
Name: NF17516_high_25
Description: NF17516
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17516_high_25 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 243; Significance: 1e-135; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 243; E-Value: 1e-135
Query Start/End: Original strand, 19 - 265
Target Start/End: Complemental strand, 52605370 - 52605124
Alignment:
| Q |
19 |
agaattgaagtgaattaatgaggtttggtgaaatttctgaccaaagagatgtgatgtatcaaattcaaagtcttttactgcatatatccgaggtaccata |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52605370 |
agaattgaagtgaattaatgaggtttggtgaaatttctgaccaaagagatgtgatgtatcaaattcaaagtcttttactgcatatatccgaggtaccata |
52605271 |
T |
|
| Q |
119 |
gttaatgtcccattcttataacactctctctttccctcactaacaatataaatcaattccttttgcttcctctacctccttctttttcatctccttattt |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
52605270 |
gttaatgtcccattcttataacactctctctttccctcactaacaatataaatcaattccttttgcttcctctacctccttcttgttcatctccttattt |
52605171 |
T |
|
| Q |
219 |
tctttgccaccaatattccctatttgactcaaaaatttctaggtatt |
265 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52605170 |
tctttgccaccaatattccctatttgactcaaaaatttctaggtatt |
52605124 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 40; Significance: 0.0000000000001; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 20 - 133
Target Start/End: Complemental strand, 16906283 - 16906179
Alignment:
| Q |
20 |
gaattgaagtgaattaatgaggtttggtgaaatttctgaccaaagagatgtgatgtatcaaattcaaagtcttttactgcatatatccgaggtaccatag |
119 |
Q |
| |
|
|||||||||| ||||||||||||||||| |||||||||||||| ||||||||||||| || ||||| ||||| |||||||||||||||||| |
|
|
| T |
16906283 |
gaattgaagtcaattaatgaggtttggtacaatttctgaccaaa---ttgtgatgtatcaaggtc----tctttaactgc--atatccgaggtaccatag |
16906193 |
T |
|
| Q |
120 |
ttaatgtcccattc |
133 |
Q |
| |
|
||||||||| |||| |
|
|
| T |
16906192 |
ttaatgtcctattc |
16906179 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University