View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17516_high_27 (Length: 282)
Name: NF17516_high_27
Description: NF17516
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17516_high_27 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 17 - 270
Target Start/End: Original strand, 32334192 - 32334445
Alignment:
| Q |
17 |
acctttctgatgcatgagatgacttgcataataaaggttaaattgacattacattaccacaaaaacactttgaaattcgtatgcatttcctcaaaactac |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32334192 |
acctttctgatgcatgagatgacttgcataataaaggttaaattgacattacattaccacaaaaacactttgaaattcgtatgcatttcctcaaaactac |
32334291 |
T |
|
| Q |
117 |
tagtactaatctatgac-acgacacg----ttatactggtaataatttagttaaaagagagtatttgaatataactatatgtgtgtggatgttgtattgg |
211 |
Q |
| |
|
||||||||||||||||| | |||||| |||| |||||||||||||||||| |||||||||||||||| |||||||||||||||| ||||||| |
|
|
| T |
32334292 |
tagtactaatctatgacaaggacacggcacgtataatggtaataatttagttaa-----agtatttgaatataaccatatgtgtgtggatgtcgtattgg |
32334386 |
T |
|
| Q |
212 |
tgtcacacacttactcgtgtcgaacaccaaatacatcttcaatttgaagtgtctgtgct |
270 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
32334387 |
tgtcacacacctactcgtgtcgaacaccaaatacatgttcaatttgaagtgtctgtgct |
32334445 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University