View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17516_high_35 (Length: 216)
Name: NF17516_high_35
Description: NF17516
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17516_high_35 |
 | |
|
| [»] scaffold0057 (1 HSPs) |
| | |
|
Alignment Details
Target: chr4 (Bit Score: 171; Significance: 5e-92; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 171; E-Value: 5e-92
Query Start/End: Original strand, 14 - 200
Target Start/End: Complemental strand, 42471723 - 42471537
Alignment:
| Q |
14 |
taattctgcatttccttcatctaggaacaacgaagcttactttttcatgaatgataaatacgtactattggattatgctccgggaacccccaacgatgag |
113 |
Q |
| |
|
|||| ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42471723 |
taatgctgcatttcgttcatctaggaacaacgaagcttactttttcatgaatgataaatacgtactattggattatgctccgggaacccccaacgatgag |
42471624 |
T |
|
| Q |
114 |
gttttgaacgggcctgaatttgttcgtgatgggttctgttcacttgctcataccgtatttggaagctatggaattgattgtgccttt |
200 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42471623 |
gttttgaacggacctgaatttgttcgtgatgggttccgttcacttgctcataccgtatttggaagctatggaattgattgtgccttt |
42471537 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 75; Significance: 1e-34; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 19 - 200
Target Start/End: Original strand, 3352063 - 3352244
Alignment:
| Q |
19 |
ctgcatttccttcatctaggaacaacgaagcttactttttcatgaatgataaatacgtactattggattatgctccgggaacccccaacgatgaggtttt |
118 |
Q |
| |
|
||||||||| ||||||||||||||| |||||||||||||||||||||||||| || | |||||||| ||||| |||||||| ||||||| || |||| |
|
|
| T |
3352063 |
ctgcatttcgttcatctaggaacaatgaagcttactttttcatgaatgataagtatatcctattggactatgcaccgggaactggcaacgataagatttt |
3352162 |
T |
|
| Q |
119 |
gaacgggcctgaat-ttgttcgtgatgggttctgttcacttgctcataccgtatttggaagctatggaattgattgtgccttt |
200 |
Q |
| |
|
| | ||||| || | ||||||| |||||||| | ||||||||||||||| ||||||||||||||||||| |||||| ||||| |
|
|
| T |
3352163 |
gtatgggcc-gagtcttgttcgcgatgggtttagatcacttgctcataccatatttggaagctatggaatagattgttccttt |
3352244 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 19 - 196
Target Start/End: Complemental strand, 42046534 - 42046354
Alignment:
| Q |
19 |
ctgcatttccttcatctaggaacaacgaagcttactttttcatgaatgat---aaatacgtactattggattatgctccgggaacccccaacgatgaggt |
115 |
Q |
| |
|
|||| |||| |||||||||| |||| ||||||||| ||||||| |||||| || ||||| ||||||||||||||||| |||||| |||||||| || | |
|
|
| T |
42046534 |
ctgcttttcgttcatctaggcacaatgaagcttacattttcatcaatgatgataagtacgtgctattggattatgctcctggaaccaccaacgataagat |
42046435 |
T |
|
| Q |
116 |
tttgaacgggcctgaatttgttcgtgatgggttctgttcacttgctcataccgtatttggaagctatggaattgattgtgc |
196 |
Q |
| |
|
|||| | ||||| ||||| |||||||||| |||||||||| ||| ||||| |||||||| |||||||||||| |
|
|
| T |
42046434 |
tttgcatgggccatctcttgttagtgatgggtttaaatcacttgctcctacaatatttcaaagctatgcaattgattgtgc |
42046354 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 153 - 200
Target Start/End: Original strand, 14452478 - 14452525
Alignment:
| Q |
153 |
tcacttgctcataccgtatttggaagctatggaattgattgtgccttt |
200 |
Q |
| |
|
|||| ||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
14452478 |
tcacatgctcatacaatatttggaagctatggaattgattgtgccttt |
14452525 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0057 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: scaffold0057
Description:
Target: scaffold0057; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 23 - 200
Target Start/End: Complemental strand, 63717 - 63540
Alignment:
| Q |
23 |
atttccttcatctaggaacaacgaagcttactttttcatgaatgataaatacgtactattggattatgctccgggaacccccaacgatgaggttttgaac |
122 |
Q |
| |
|
||||| ||||||||| || || ||||| ||||||||||| |||||||| | | ||||||||||||||||| |||||| ||||||| || |||| | |
|
|
| T |
63717 |
atttcgttcatctagaaaaaatgaagcatactttttcatcaatgataagctcttgctattggattatgctcccggaaccagcaacgataagattttatat |
63618 |
T |
|
| Q |
123 |
gggcctgaatttgttcgtgatgggttctgttcacttgctcataccgtatttggaagctatggaattgattgtgccttt |
200 |
Q |
| |
|
|| ||| |||||||| ||||||| || |||| | ||||| |||||||||| ||||||| |||||||||||| |
|
|
| T |
63617 |
ggacctatttttgttcgccatgggtttccatcgcttgataataccaaatttggaagcaatggaatagattgtgccttt |
63540 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University