View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17516_low_28 (Length: 284)
Name: NF17516_low_28
Description: NF17516
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17516_low_28 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 12 - 269
Target Start/End: Original strand, 41293742 - 41293996
Alignment:
| Q |
12 |
atagggttgtgaataaacacgaccgttaaaccaacgggttgtgacttatgagtgcacacaacctatattcagtgttgcatgaatcgctctatatatgatc |
111 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41293742 |
atagggttgtgaatacacacgaccgttaaaccaacgggttgtgacttatgagtgcacacaacctatattcagtgttgcatgaatcgctctatatatgatc |
41293841 |
T |
|
| Q |
112 |
gatttatggatcagtcctaggnnnnnnnnntgttgctgtaaattttgtcatgtcgctagttggaggagtctctaaattattaatttattttagaggggac |
211 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
41293842 |
gatttatggatcagtcctaggaaaaaaaaatgttgctgtaaattttgtcatgtcgctagttggaggagtctctaa---attaatttattttagaggggac |
41293938 |
T |
|
| Q |
212 |
tctttaaattaacgttgaggatatattaannnnnnnnagagaggtgttgtattaaaat |
269 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
41293939 |
tctttaaattaacgttgaggatatattaatattttttagagaggtgttgtattaaaat |
41293996 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University