View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17516_low_35 (Length: 238)
Name: NF17516_low_35
Description: NF17516
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17516_low_35 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 181; Significance: 6e-98; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 181; E-Value: 6e-98
Query Start/End: Original strand, 18 - 226
Target Start/End: Original strand, 15179117 - 15179325
Alignment:
| Q |
18 |
gaagagtggtgtacccaattgaatatggtgcagatccaactggagtgaatgaaagcagtgatgccattatgaaagctatagaagctgcatttgagatgga |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||||| || || |
|
|
| T |
15179117 |
gaagagtggtgtacccaattgaatatggtgcagatccaactggagtgaatgaaagcagtgatgccatgatgaaagctgtagaagctgcatttgatattga |
15179216 |
T |
 |
| Q |
118 |
taatttagggcttgaattattaccaggaattagagaccttggaggtgttatcattgattttcaaggtggaaactacaaaatcaacaatcccatcacattt |
217 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||| |
|
|
| T |
15179217 |
taatttagggcttgaattattactaggaattagagaccttggaggtgttatcattgattttcaaggtggaaactataaaatcagcaatcccatcacattt |
15179316 |
T |
 |
| Q |
218 |
ccttcatct |
226 |
Q |
| |
|
||||||||| |
|
|
| T |
15179317 |
ccttcatct |
15179325 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 158 - 200
Target Start/End: Complemental strand, 38860572 - 38860530
Alignment:
| Q |
158 |
ggaggtgttatcattgattttcaaggtggaaactacaaaatca |
200 |
Q |
| |
|
||||||||||| |||||||| ||||||||| |||||||||||| |
|
|
| T |
38860572 |
ggaggtgttattattgatttgcaaggtggagactacaaaatca |
38860530 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University