View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17516_low_37 (Length: 222)
Name: NF17516_low_37
Description: NF17516
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17516_low_37 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 98; Significance: 2e-48; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 98; E-Value: 2e-48
Query Start/End: Original strand, 10 - 111
Target Start/End: Original strand, 4325353 - 4325454
Alignment:
| Q |
10 |
catcatcattaggtaagttcagtgtgaaaacaagatcatcatggcgcattaattgtacatttgtgtgtaaagctctatttgggccactctcttatgaatc |
109 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4325353 |
catcatcattaggtaagttcagtgtgaaaacaagatcatcatggcacattaattgtacatttgtgtgtaaagctctatttgggccactctcttatgaatc |
4325452 |
T |
 |
| Q |
110 |
aa |
111 |
Q |
| |
|
|| |
|
|
| T |
4325453 |
aa |
4325454 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 90; E-Value: 1e-43
Query Start/End: Original strand, 111 - 204
Target Start/End: Original strand, 4328905 - 4328998
Alignment:
| Q |
111 |
atgccatgccatcatgcactgctgccccaccactactttttagtggaatcaatagcattgcacattcccctagccacaccatgtgtgacaaaac |
204 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4328905 |
atgccatgccatcatgcaccgctgccccaccactactttttagtggaatcaatagcattgcacattcccctagccacaccatgtgtgacaaaac |
4328998 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 133 - 165
Target Start/End: Original strand, 48225246 - 48225278
Alignment:
| Q |
133 |
tgccccaccactactttttagtggaatcaatag |
165 |
Q |
| |
|
|||||||||||||||||||| |||||||||||| |
|
|
| T |
48225246 |
tgccccaccactactttttattggaatcaatag |
48225278 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University