View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17517_low_4 (Length: 364)
Name: NF17517_low_4
Description: NF17517
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17517_low_4 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 317; Significance: 1e-179; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 317; E-Value: 1e-179
Query Start/End: Original strand, 12 - 348
Target Start/End: Complemental strand, 2855265 - 2854929
Alignment:
| Q |
12 |
aagaatatgatggttatattaataaaggtatggttggttatttcttgacaatatcaaaggaaatttcttgttttcttaattccaacataaatggtgtcta |
111 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2855265 |
aagaaaatgatggttatattaataaaggtatggttggttatttcttgacaatatcaaaggaaatttcttgttttcttaattccaacataaatggtgtcta |
2855166 |
T |
 |
| Q |
112 |
tttaattgttctatggtcatggtcatgtaatgttggcctgctttttcttgtttgtttctgctttgattctgtcttcaatatgttattatatttgtgattt |
211 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2855165 |
tttagttgttctatggtcatggtcatgtaatgttggcctgctttttcttgtttgtttatgctttgattctgtcttcaatatgttattatatttgtgattt |
2855066 |
T |
 |
| Q |
212 |
tttgggtaggatttgtggtatttgaaaattggacagatatttttcagttgtttcctagaagttgtgtctgaaatttgaggtcaatgtcatattttcactt |
311 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||| |
|
|
| T |
2855065 |
tttgggtaggatttgtggtatttgaaaattggacagatatttttcagttgtttcctagaagttgtgtctgaaatttgaggtcaacgtcatatttccactt |
2854966 |
T |
 |
| Q |
312 |
actctactacctctcttataccacttaggtctcaact |
348 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2854965 |
actctactacctctcttataccacttaggtctcaact |
2854929 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 106 - 189
Target Start/End: Complemental strand, 2850224 - 2850141
Alignment:
| Q |
106 |
tgtctatttaattgttctatggtcatggtcatgtaatgttggcctgcttttt-cttgtttgtttctgctttgattctgtcttcaa |
189 |
Q |
| |
|
||||| |||| |||| ||||||||| ||||||||| |||||||||||||||| ||||| |||||||||||||||| ||||||||| |
|
|
| T |
2850224 |
tgtctgtttagttgtgctatggtcaaggtcatgta-tgttggcctgcttttttcttgtctgtttctgctttgattttgtcttcaa |
2850141 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 46 - 87
Target Start/End: Complemental strand, 2850828 - 2850787
Alignment:
| Q |
46 |
tggttatttcttgacaatatcaaaggaaatttcttgttttct |
87 |
Q |
| |
|
|||||||||||||||| |||||||| |||||||||||||||| |
|
|
| T |
2850828 |
tggttatttcttgacactatcaaagaaaatttcttgttttct |
2850787 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 45; Significance: 1e-16; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 25 - 192
Target Start/End: Complemental strand, 10477198 - 10477032
Alignment:
| Q |
25 |
ttatattaataaaggtatggttggttatttcttgacaatatcaaaggaaatttc-ttgttttcttaattccaacataaatgg--tgtctatttaattgtt |
121 |
Q |
| |
|
||||| ||||||| |||| || ||||||||||||||||||||||||||| ||| ||||||| | ||||||||||||||||| | ||| ||| ||||| |
|
|
| T |
10477198 |
ttataataataaaaatatgctttgttatttcttgacaatatcaaaggaaagttctttgttttatgaattccaacataaatggaatttctttttggttgtt |
10477099 |
T |
 |
| Q |
122 |
ctatggtcatggtcatgtaatgttggcctg-ctttttcttgtttgtttctgctttgattctgtcttcaatat |
192 |
Q |
| |
|
||| ||||| ||| ||||| ||||| ||||||||||| |||||||| ||||||| |||||| ||||| |
|
|
| T |
10477098 |
ttatagtcat-----tgtcatgttagcctgcctttttcttgtctgtttctggtttgattttgtcttgaatat |
10477032 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University