View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17517_low_5 (Length: 340)
Name: NF17517_low_5
Description: NF17517
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17517_low_5 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 314; Significance: 1e-177; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 314; E-Value: 1e-177
Query Start/End: Original strand, 1 - 322
Target Start/End: Original strand, 12647997 - 12648318
Alignment:
| Q |
1 |
atcgaattccgatttatttgttttgaggattgtgaaatgagtcagcgacaagctcagcatcaagctcaaagaccacatcctcaagccccatttcaatgat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12647997 |
atcgaattccgatttatttgttttgaggattgtgaaatgagtcagcgacaagctcagcatcaagctcaaagaccacatcctcaagccccatttcaatgat |
12648096 |
T |
|
| Q |
101 |
tcattgcatagaccacaccctcacacaaatgcttatacctaccaagtcacgattatgagagaaaggtgcatcaacattgcatttcaggaatttagcattg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12648097 |
tcattgcatagaccacaccctcacacaaatgcttatacctaccaagtcacgattatgagagaaaggtgcatcaacattgcatttcaggaatttagcattg |
12648196 |
T |
|
| Q |
201 |
ggagggagcaacgttataatatggctttggggctgctgttgctcaatctccccttccattgtcgtagcatatttgccacttgtgtataatatctccattc |
300 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
12648197 |
ggagggagcaacgttttaatatggctttggggctgctgttgctcaatctccccttccattgtcgtagcatatttgccacttgtgtataatatttccattc |
12648296 |
T |
|
| Q |
301 |
cacaggggctggtttcggctat |
322 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
12648297 |
cacaggggctggtttcggctat |
12648318 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 87; E-Value: 1e-41
Query Start/End: Original strand, 101 - 203
Target Start/End: Original strand, 12655198 - 12655300
Alignment:
| Q |
101 |
tcattgcatagaccacaccctcacacaaatgcttatacctaccaagtcacgattatgagagaaaggtgcatcaacattgcatttcaggaatttagcattg |
200 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||| |||||||| ||||||||||||||||||||||||| |
|
|
| T |
12655198 |
tcattgcatagaccacaccctcacataaatgcttatacctaccaagtcacgaatatgagagaaagatgcatcaatattgcatttcaggaatttagcattg |
12655297 |
T |
|
| Q |
201 |
gga |
203 |
Q |
| |
|
||| |
|
|
| T |
12655298 |
gga |
12655300 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University