View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17517_low_9 (Length: 231)

Name: NF17517_low_9
Description: NF17517
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17517_low_9
NF17517_low_9
[»] chr3 (1 HSPs)
chr3 (15-215)||(26520-26720)


Alignment Details
Target: chr3 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 15 - 215
Target Start/End: Complemental strand, 26720 - 26520
Alignment:
15 tatcatgtagtttactgaatgtggaaagtgtgatagatgatgatgcatgtgaattagtcagtggagaggagctttcattagaggatggcgatgataatgt 114  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||    
26720 tatcatgtagtttactgaatgtggaaagtgtgatagatgatgatgcatgtgaattagtcagtggagaggagctttcgttagaggatggcgatgataatgt 26621  T
115 tcatgcttatcttttcaaggcagtaaaaaataacaatggaattggcctattgcttctttctgatgtttatgggtttgaggactcctccacaagagatttt 214  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
26620 tcatgcttatcttttcaaggcagtaaaaaataacaatggaattggcctattgcttctttctgatgtttatgggtttgaggactcctccacaagagatttt 26521  T
215 g 215  Q
    |    
26520 g 26520  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University