View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17518_high_16 (Length: 345)
Name: NF17518_high_16
Description: NF17518
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17518_high_16 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 322; Significance: 0; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 322; E-Value: 0
Query Start/End: Original strand, 1 - 330
Target Start/End: Complemental strand, 31785328 - 31784999
Alignment:
| Q |
1 |
taaagactaagatagtttcactatatgctacagctaaattatacattcaaaaagaaaagacaacaatcactgaagggtattcaatctaaaactatccttg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
31785328 |
taaagactaagatagtttcactatatgctacagctaaattatacattcaaaaagaaaagacaacaatcaccgaagggtattcaatctaaaactatccttg |
31785229 |
T |
 |
| Q |
101 |
gtggaaggtgcacacttgaagcttgctctggacatgtaacaagtttcacaatagaactggcggtgagattgtatcttctccgcacttcagtgaatccacc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31785228 |
gtggaaggtgcacacttgaagcttgctctggacatgtaacaagtttcacaatagaactggcggtgagattgtatcttctccgcacttcagtgaatccacc |
31785129 |
T |
 |
| Q |
201 |
atagagaacttgctgaacccagttctccacctccgtatcactgtccgagacgtatgcagctgcaagcaattgatccatgacttctgtttggatttgtaag |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31785128 |
atagagaacttgctgaacccagttctccacctccgtatcactgtccgagacgtatgcagctgcaagcaattgatccatgacttctgtttggatttgtaag |
31785029 |
T |
 |
| Q |
301 |
gcacactcggatccaagaattttgtcgaag |
330 |
Q |
| |
|
||||||||||||||||||||||||| |||| |
|
|
| T |
31785028 |
gcacactcggatccaagaattttgttgaag |
31784999 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University