View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17518_high_32 (Length: 223)
Name: NF17518_high_32
Description: NF17518
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17518_high_32 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 163; Significance: 3e-87; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 163; E-Value: 3e-87
Query Start/End: Original strand, 7 - 223
Target Start/End: Original strand, 16905721 - 16905934
Alignment:
| Q |
7 |
atgtaatggatttggacctgtaggaacatgtctcttgtcatctgagttagtgttcttcttagagcatagcacaaatttgtttttcttgtgatggttacat |
106 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
16905721 |
atgtaatggatttggacctgtaggaacatgtctcttgtcatctgagtcagtgttcttcttagagcatagcacaaatttgtttttcttgtg---gttacat |
16905817 |
T |
|
| Q |
107 |
ttgtggatatgaagtgtctgatcacttgtcttctttgcaccatgatacagggtctttcttaccatcatgttggaaccaacacaatcagataacataaggc |
206 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||||||||||||| |||| |||| || || |
|
|
| T |
16905818 |
ttgtggacatgaagtgtctgatcacttgtcttctttgcaccatgaaacaaggtctttcttaccatcatgttggaaccaacacaagcagagaacaaaaagc |
16905917 |
T |
|
| Q |
207 |
acaagaacataactatc |
223 |
Q |
| |
|
| || |||||||||||| |
|
|
| T |
16905918 |
ataacaacataactatc |
16905934 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University