View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17518_low_26 (Length: 254)
Name: NF17518_low_26
Description: NF17518
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17518_low_26 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 220; Significance: 1e-121; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 18 - 241
Target Start/End: Original strand, 10869538 - 10869761
Alignment:
| Q |
18 |
caaacaagagaagcaaagtagagtaactgtgatcattgaaggagtttcacaatggtaaagaaagaagaatttctgagagaaaacggttttgagaaagaag |
117 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10869538 |
caaacaagagaagcaaagtagagtagctgtgatcattgaaggagtttcacaatggtaaagaaagaagaatttctgagagaaaacggttttgagaaagaag |
10869637 |
T |
|
| Q |
118 |
gactagaagaagtctcacgcagtgacttcccttctgatttcgtcttcggagtcgccacttctgcttatcaggtacgtcatcaatgcagattcactgtctc |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10869638 |
gactagaagaagtctcacgcagtgacttcccttctgatttcgtcttcggagtcgccacttctgcttatcaggtacgtcatcaatgcagattcactgtctc |
10869737 |
T |
|
| Q |
218 |
gatcttcttgtttttctactctct |
241 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
10869738 |
gatcttcttgtttttctactctct |
10869761 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 93; E-Value: 2e-45
Query Start/End: Original strand, 68 - 232
Target Start/End: Original strand, 10855789 - 10855949
Alignment:
| Q |
68 |
aatggtaaagaaagaagaatttctgagagaaaacggttttgagaaagaaggactagaagaagtctcacgcagtgacttcccttctgatttcgtcttcgga |
167 |
Q |
| |
|
|||||||||||||||||| ||||| |||||||||||||||||||||||| || ||||||||||||||||||||||||| || |||||||||||| |
|
|
| T |
10855789 |
aatggtaaagaaagaagagtttctaagagaaaacggttttgagaaagaac------aaaaagtctcacgcagtgacttcccttccgacttcgtcttcgga |
10855882 |
T |
|
| Q |
168 |
gtcgccacttctgcttatcaggtacgtcatcaatgcagatt--cactgtctcgatcttcttgttttt |
232 |
Q |
| |
|
|||||||| |||||||||||||||||||| ||||||||||| ||||||||||||||| || ||||| |
|
|
| T |
10855883 |
gtcgccacctctgcttatcaggtacgtcaccaatgcagattcacactgtctcgatcttgtttttttt |
10855949 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University