View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17518_low_30 (Length: 240)
Name: NF17518_low_30
Description: NF17518
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17518_low_30 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 130; Significance: 2e-67; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 130; E-Value: 2e-67
Query Start/End: Original strand, 90 - 227
Target Start/End: Complemental strand, 9165816 - 9165679
Alignment:
| Q |
90 |
ttaactcggtataaattgaaaactttcaaatcagattttgtatttattctttctgtaagtatagttgtacctgtatatctgttaaaggtgatgattggga |
189 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
9165816 |
ttaactcggtataaattgaaaactttcaaatcagagtttgtatttattctttctgtaagtatagttgtacctgtatatctgttacaggtgatgattggga |
9165717 |
T |
 |
| Q |
190 |
gcatgaagagattttcactgatgatgatgaagctcctg |
227 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9165716 |
gcatgaagagattttcactgatgatgatgaagctcctg |
9165679 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 133 - 223
Target Start/End: Complemental strand, 9154524 - 9154436
Alignment:
| Q |
133 |
ttattctttctgtaagtatagttgtacctgtatatctgttaaaggtgatgattgggagcatgaagagattttcactgatgatgatgaagct |
223 |
Q |
| |
|
|||||||||||| ||||||||||| | |||| | |||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9154524 |
ttattctttctg--agtatagttgtgcttgtacacctgttacaggtgatgattgggagcatgaagagattttcactgatgatgatgaagct |
9154436 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 1 - 46
Target Start/End: Complemental strand, 9165913 - 9165868
Alignment:
| Q |
1 |
aactaattagcttgactataccgttgattctctctttctctctctc |
46 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
9165913 |
aactaattagcttgactataccgttgattctctctctctctctctc |
9165868 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University