View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17518_low_32 (Length: 235)

Name: NF17518_low_32
Description: NF17518
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17518_low_32
NF17518_low_32
[»] chr8 (2 HSPs)
chr8 (8-221)||(9336584-9336797)
chr8 (107-177)||(8209356-8209426)
[»] chr1 (1 HSPs)
chr1 (107-192)||(42365183-42365268)


Alignment Details
Target: chr8 (Bit Score: 182; Significance: 2e-98; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 8 - 221
Target Start/End: Original strand, 9336584 - 9336797
Alignment:
8 cacagtctttttgagaaaatgacctaacagattcaaagttctaactccacccaaatcaccgttaaaagcaaaaaccctacctaccaaaaactgagacatt 107  Q
    |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||    
9336584 cacagtctttttgagaaaatgacctaccagattcaaagttctaactccacccaaatcaccgttaaaagcaaaaaccctacctaccaaaaactgaaacatt 9336683  T
108 aaccgaattcaaggatgcgaagatccttaggatcggtgatggatttacagatagaagccaaatcgatattcacttcacttcgcacctcccggttcgaatg 207  Q
    |||||||||||||||||||| | |||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||||||||    
9336684 aaccgaattcaaggatgcgagggtccttaggatcgatgatggatttacagatagaagccaaatcgatattcgcttcacttcgcacctcccagttcgaatg 9336783  T
208 aaaacgactatcct 221  Q
    |||| |||||||||    
9336784 aaaaagactatcct 9336797  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 107 - 177
Target Start/End: Original strand, 8209356 - 8209426
Alignment:
107 taaccgaattcaaggatgcgaagatccttaggatcggtgatggatttacagatagaagccaaatcgatatt 177  Q
    |||||||||| | | |||||| |||| ||||||||||||||||| | | ||| |||||| |||||||||||    
8209356 taaccgaattgacgaatgcgaggatcgttaggatcggtgatggagtgaaagagagaagctaaatcgatatt 8209426  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 107 - 192
Target Start/End: Original strand, 42365183 - 42365268
Alignment:
107 taaccgaattcaaggatgcgaagatccttaggatcggtgatggatttacagatagaagccaaatcgatattcacttcacttcgcac 192  Q
    |||||||||||| |||||||| | || |||||||||||||| || | ||||| |||||||| ||| |||||  ||||| |||||||    
42365183 taaccgaattcacggatgcgagggtctttaggatcggtgattgagtcacagagagaagccagatcaatattggcttcatttcgcac 42365268  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University