View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17519_high_9 (Length: 209)

Name: NF17519_high_9
Description: NF17519
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17519_high_9
NF17519_high_9
[»] chr6 (1 HSPs)
chr6 (19-198)||(17361532-17361711)


Alignment Details
Target: chr6 (Bit Score: 168; Significance: 3e-90; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 168; E-Value: 3e-90
Query Start/End: Original strand, 19 - 198
Target Start/End: Original strand, 17361532 - 17361711
Alignment:
19 ctttcgacaaagaaaaaattgtttacggtggctcttgccatggaatcctttgtttagctaggaaacaagactatagggctaaagtaaaagatgtaatctt 118  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||    
17361532 ctttcgacaaagaaaaaattgtttacggtggctcttgccatggaatcctttgtttagctaggaaacaagactctagggctaaagtaaaagatgtaatctt 17361631  T
119 gtggaaccctaccattaaaaaattccaattagcgccttctttcaaataccctcctataagagacaactacgagtataatc 198  Q
    |||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||    
17361632 gtggaaccctgccattaaaaaattccaattatcgccttctttcaaataccctcctataagagacaactacgagtataatc 17361711  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University