View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17519_high_9 (Length: 209)
Name: NF17519_high_9
Description: NF17519
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17519_high_9 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 168; Significance: 3e-90; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 168; E-Value: 3e-90
Query Start/End: Original strand, 19 - 198
Target Start/End: Original strand, 17361532 - 17361711
Alignment:
| Q |
19 |
ctttcgacaaagaaaaaattgtttacggtggctcttgccatggaatcctttgtttagctaggaaacaagactatagggctaaagtaaaagatgtaatctt |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
17361532 |
ctttcgacaaagaaaaaattgtttacggtggctcttgccatggaatcctttgtttagctaggaaacaagactctagggctaaagtaaaagatgtaatctt |
17361631 |
T |
 |
| Q |
119 |
gtggaaccctaccattaaaaaattccaattagcgccttctttcaaataccctcctataagagacaactacgagtataatc |
198 |
Q |
| |
|
|||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17361632 |
gtggaaccctgccattaaaaaattccaattatcgccttctttcaaataccctcctataagagacaactacgagtataatc |
17361711 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University