View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17519_low_8 (Length: 214)
Name: NF17519_low_8
Description: NF17519
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17519_low_8 |
 |  |
|
| [»] scaffold0060 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr4 (Bit Score: 99; Significance: 5e-49; HSPs: 11)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 99; E-Value: 5e-49
Query Start/End: Original strand, 1 - 99
Target Start/End: Complemental strand, 3959274 - 3959176
Alignment:
| Q |
1 |
tggacacggctactgcccatgttgctagagatgaagaccaggtaaacaatcatagtactgctgcaatgaagagtgtaagcatattaagaactcaatggg |
99 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3959274 |
tggacacggctactgcccatgttgctagagatgaagaccaggtaaacaatcatagtactgctgcaatgaagagtgtaagcatattaagaactcaatggg |
3959176 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 95; E-Value: 1e-46
Query Start/End: Original strand, 97 - 195
Target Start/End: Complemental strand, 3957872 - 3957774
Alignment:
| Q |
97 |
gggtgttgtccttgctgtaaccttgattttaaaccttgtctgcttttttgctatgctagttaggtagcgcgaacatggtgggtcgtatatcatgcatac |
195 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
3957872 |
gggtgttgtccttgctgtaaccttgattttaaaccttgtctgcttttttgctatgctagttaggtagcgtgaacatggtgggtcgtatatcatgcatac |
3957774 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 54; E-Value: 3e-22
Query Start/End: Original strand, 103 - 192
Target Start/End: Original strand, 4022830 - 4022919
Alignment:
| Q |
103 |
tgtccttgctgtaaccttgattttaaaccttgtctgcttttttgctatgctagttaggtagcgcgaacatggtgggtcgtatatcatgca |
192 |
Q |
| |
|
||||||||| ||||||||||||||||||||| ||| || ||||||||||||||||||||| | ||| ||||| |||||||||||||||| |
|
|
| T |
4022830 |
tgtccttgccgtaaccttgattttaaaccttctcttattgtttgctatgctagttaggtagtgagaaaatggttggtcgtatatcatgca |
4022919 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 102 - 192
Target Start/End: Original strand, 3984753 - 3984843
Alignment:
| Q |
102 |
ttgtccttgctgtaaccttgattttaaaccttgtctgcttttttgctatgctagttaggtagcgcgaacatggtgggtcgtatatcatgca |
192 |
Q |
| |
|
||||||||||||||||||||||||||| | |||||| |||| |||||||| ||||||||| | ||||||||| |||||||||||||||| |
|
|
| T |
3984753 |
ttgtccttgctgtaaccttgattttaacctgtgtctgacttttggctatgctggttaggtagtgagaacatggttggtcgtatatcatgca |
3984843 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 50; E-Value: 8e-20
Query Start/End: Original strand, 103 - 192
Target Start/End: Original strand, 4007672 - 4007761
Alignment:
| Q |
103 |
tgtccttgctgtaaccttgattttaaaccttgtctgcttttttgctatgctagttaggtagcgcgaacatggtgggtcgtatatcatgca |
192 |
Q |
| |
|
||||||||||||||||||||||||||||||||| || || ||||||| ||||||||||| || |||||| || |||||| ||||||||| |
|
|
| T |
4007672 |
tgtccttgctgtaaccttgattttaaaccttgtatgattctttgctactctagttaggtaccgagaacatcgttggtcgtgtatcatgca |
4007761 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #6
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 108 - 195
Target Start/End: Original strand, 3815439 - 3815526
Alignment:
| Q |
108 |
ttgctgtaaccttgattttaaaccttgtctgcttttttgctatgctagttaggtagcgcgaacatggtgggtcgtatatcatgcatac |
195 |
Q |
| |
|
|||||||||||||||||||||| |||||||| ||||||||||| ||||||||||| | |||||| || |||| | |||||||||||| |
|
|
| T |
3815439 |
ttgctgtaaccttgattttaaagcttgtctgattttttgctattctagttaggtacccagaacatcgttggtcctgtatcatgcatac |
3815526 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #7
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 102 - 189
Target Start/End: Original strand, 3999874 - 3999961
Alignment:
| Q |
102 |
ttgtccttgctgtaaccttgattttaaaccttgtctgcttttttgctatgctagttaggtagcgcgaacatggtgggtcgtatatcat |
189 |
Q |
| |
|
|||||||||||| |||||||||||| |||||||| || ||||| ||||| ||||||||||| | ||| ||||||||||||||||||| |
|
|
| T |
3999874 |
ttgtccttgctgcaaccttgattttgaaccttgtatgatttttcgctattctagttaggtactgagaaaatggtgggtcgtatatcat |
3999961 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #8
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 97 - 161
Target Start/End: Complemental strand, 3922416 - 3922352
Alignment:
| Q |
97 |
gggtgttgtccttgctgtaaccttgattttaaaccttgtctgcttttttgctatgctagttaggt |
161 |
Q |
| |
|
|||| |||||| ||||||||||||||||||||| |||||||| ||||||||||| |||||||||| |
|
|
| T |
3922416 |
gggtattgtccatgctgtaaccttgattttaaagcttgtctgattttttgctattctagttaggt |
3922352 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #9
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 106 - 162
Target Start/End: Complemental strand, 3935767 - 3935711
Alignment:
| Q |
106 |
ccttgctgtaaccttgattttaaaccttgtctgcttttttgctatgctagttaggta |
162 |
Q |
| |
|
|||||||||||||||||||||||| |||||||| ||||||||||| ||||||||||| |
|
|
| T |
3935767 |
ccttgctgtaaccttgattttaaagcttgtctgattttttgctattctagttaggta |
3935711 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #10
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 103 - 192
Target Start/End: Original strand, 3998681 - 3998770
Alignment:
| Q |
103 |
tgtccttgctgtaaccttgattttaaaccttgtctgcttttttgctatgctagttaggtagcgcgaacatggtgggtcgtatatcatgca |
192 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| || || ||||||| ||||||||||| || |||||| || ||| || ||||||||| |
|
|
| T |
3998681 |
tgtccttgctgtaaccttaattttaaaccttgtatgattctttgctacactagttaggtaccgagaacattgttggttgtgtatcatgca |
3998770 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #11
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 106 - 148
Target Start/End: Original strand, 3807848 - 3807890
Alignment:
| Q |
106 |
ccttgctgtaaccttgattttaaaccttgtctgcttttttgct |
148 |
Q |
| |
|
|||| |||||||||||||||||||||||| ||| ||||||||| |
|
|
| T |
3807848 |
ccttactgtaaccttgattttaaaccttgcctgattttttgct |
3807890 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 77; Significance: 6e-36; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 77; E-Value: 6e-36
Query Start/End: Original strand, 3 - 99
Target Start/End: Original strand, 19167925 - 19168021
Alignment:
| Q |
3 |
gacacggctactgcccatgttgctagagatgaagaccaggtaaacaatcatagtactgctgcaatgaagagtgtaagcatattaagaactcaatggg |
99 |
Q |
| |
|
|||||||||| |||||||||||||||| ||||||| ||||||||||||| |||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
19167925 |
gacacggctattgcccatgttgctagatatgaagatcaggtaaacaatcctagtactgctgcaatgaagagtgttagcatattaagaactcaatggg |
19168021 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0060 (Bit Score: 48; Significance: 1e-18; HSPs: 1)
Name: scaffold0060
Description:
Target: scaffold0060; HSP #1
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 44 - 99
Target Start/End: Original strand, 18706 - 18761
Alignment:
| Q |
44 |
aaacaatcatagtactgctgcaatgaagagtgtaagcatattaagaactcaatggg |
99 |
Q |
| |
|
|||||||| |||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
18706 |
aaacaatcctagtactgcttcaatgaagagtgtaagcatattaagaactcaatggg |
18761 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University