View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1751R-Insertion-11 (Length: 268)
Name: NF1751R-Insertion-11
Description: NF1751R
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1751R-Insertion-11 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 225; Significance: 1e-124; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 225; E-Value: 1e-124
Query Start/End: Original strand, 9 - 268
Target Start/End: Complemental strand, 31789943 - 31789683
Alignment:
| Q |
9 |
ctgatgagtaatccccctccttcagatgcaattccatttattgacttccttggagtaggagccacatgatcaaagttataaactaatcaaaaagctgcaa |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31789943 |
ctgatgagtaatccccctccttcagatgcaattccatttattgacttccttggagtaggagccacatgatcaaagttataaactaatcaaaaagctgcaa |
31789844 |
T |
|
| Q |
109 |
tgcaacccnnnnnnnnc-ccattgaagctcctcaatataggtgtggtccaacattacctaaaaaccattcgaggtaaacagaaaggatagttgctctact |
207 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31789843 |
tgcaacccttttttttttccattgaagctcctcaatataggtgtggtccaacattacctaaaaaccattcgaggtaaacagaaaggatagttgctctact |
31789744 |
T |
|
| Q |
208 |
ttggtcactgtgttacttgcgtcatttctgttcatatcacctatctctcttctcatttcct |
268 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31789743 |
ttggtcactgtgttacttgcgtcatttctgttcatatcacctatctctcttctcatttcct |
31789683 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University