View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1751R-Insertion-15 (Length: 106)
Name: NF1751R-Insertion-15
Description: NF1751R
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1751R-Insertion-15 |
 | |
|
| [»] chr6 (1 HSPs) |
| |
|
Alignment Details
Target: chr6 (Bit Score: 91; Significance: 6e-45; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 91; E-Value: 6e-45
Query Start/End: Original strand, 12 - 106
Target Start/End: Complemental strand, 22418150 - 22418056
Alignment:
| Q |
12 |
taatgtttaaatgcatatggttattaattttgaagaggcacataggatgatttttattttgaagggttgatgaactatgaagatgatgatgatgt |
106 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22418150 |
taatgtttaaatgcatatggttcttaattttgaagaggcacataggatgatttttattttgaagggttgatgaactatgaagatgatgatgatgt |
22418056 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 83; Significance: 4e-40; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 83; E-Value: 4e-40
Query Start/End: Original strand, 12 - 102
Target Start/End: Complemental strand, 12813310 - 12813220
Alignment:
| Q |
12 |
taatgtttaaatgcatatggttattaattttgaagaggcacataggatgatttttattttgaagggttgatgaactatgaagatgatgatg |
102 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12813310 |
taatgtttaaatgcatatggttcttaattttgaagaggcacataggatgacttttattttgaagggttgatgaactatgaagatgatgatg |
12813220 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 39; Significance: 0.0000000000001; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 39; E-Value: 0.0000000000001
Query Start/End: Original strand, 51 - 101
Target Start/End: Complemental strand, 14998326 - 14998276
Alignment:
| Q |
51 |
acataggatgatttttattttgaagggttgatgaactatgaagatgatgat |
101 |
Q |
| |
|
||||| ||||||||||||||||||||||| ||||| ||||||||||||||| |
|
|
| T |
14998326 |
acataagatgatttttattttgaagggtttatgaattatgaagatgatgat |
14998276 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University