View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1751R-Insertion-7 (Length: 355)
Name: NF1751R-Insertion-7
Description: NF1751R
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1751R-Insertion-7 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 333; Significance: 0; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 333; E-Value: 0
Query Start/End: Original strand, 9 - 349
Target Start/End: Complemental strand, 34141523 - 34141183
Alignment:
| Q |
9 |
actatctcgcgctggattacgttcaaagaggatggtggtgatacttaaggatgcactggagagattgtggccggtcctttgccttgaacaaacttcgttg |
108 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34141523 |
actatctcgcgctggattgcgttcaaagaggatggtggtgatacttaaggatgcactggagagattgtggccggtcctttgccttgaacaaacttcgttg |
34141424 |
T |
 |
| Q |
109 |
acaagtggatggccagattttcgaatagcaaataatattaaatcaggtgatgcgtgtgattttcgggttgaggacaagtctaaatgtatcgttgctgtag |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34141423 |
acaagtggatggccagattttcgaatagcaaataatattaaatcaggtgatgcgtgtgattttcgggttgaggacaagtctaaatgtatcgttgctgtag |
34141324 |
T |
 |
| Q |
209 |
atattcaccacaagtgatgttagtcgagtcatgtgctgcgatgtttaggcgttcttttgctacctctctgccttgtgtactataatagttttgtatcaac |
308 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34141323 |
atattcaccacaagtgatgttagtcgagtcatgtgctgcgatgtttaggcgttcttttgctacctctctgccttgtgtactataatagttttgtatcaac |
34141224 |
T |
 |
| Q |
309 |
gaaaacctgagcactgttcctaaattatattactcttgtta |
349 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
34141223 |
gaaaacctgagcactgttcttaaattatattactcttgtta |
34141183 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University