View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1751_high_1 (Length: 438)
Name: NF1751_high_1
Description: NF1751
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1751_high_1 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 82; Significance: 1e-38; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 82; E-Value: 1e-38
Query Start/End: Original strand, 43 - 124
Target Start/End: Complemental strand, 46902121 - 46902040
Alignment:
| Q |
43 |
atggagtgggattggctgggatcaatttggtttgcttctccttttggaatcaccttccaatacatgagtctaaaaacatgag |
124 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46902121 |
atggagtgggattggctgggatcaatttggtttgcttctccttttggaatcaccttccaatacatgagtctaaaaacatgag |
46902040 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 75; E-Value: 2e-34
Query Start/End: Original strand, 117 - 207
Target Start/End: Complemental strand, 46902019 - 46901929
Alignment:
| Q |
117 |
aacatgaggtatggttgcgtttagttccagcagcagaacaataatatctgcatgggagcgattgttcaagatttgcttgatgaatttattt |
207 |
Q |
| |
|
|||| ||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46902019 |
aacaggaggtatggttgcatttagttccagcacaagaacaataatatctgcatgggagcgattgttcaagatttgcttgatgaatttattt |
46901929 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 221 - 271
Target Start/End: Complemental strand, 46901713 - 46901663
Alignment:
| Q |
221 |
tatagatataattgacaagtgaaaaccattttcaattaagagcacaacata |
271 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
46901713 |
tatagatataattgacaagtgaaaaccattttcaatcaagagcacaacata |
46901663 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University