View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1751_low_11 (Length: 239)
Name: NF1751_low_11
Description: NF1751
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1751_low_11 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 92; Significance: 8e-45; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 92; E-Value: 8e-45
Query Start/End: Original strand, 1 - 96
Target Start/End: Complemental strand, 22592311 - 22592216
Alignment:
| Q |
1 |
ttagtaatatgtggatcaaatttcagaagcttttaagtgtggcaagacaccaatcgaccaagttcaaagttaccaggtacagtgaaagcttcttgc |
96 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
22592311 |
ttagtaatatgtggatcaaatttcagaagcttttaagtgtggcaagacaccaatcgaccaagttcaaagttaccaagtacagtgaaagcttcttgc |
22592216 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 187 - 231
Target Start/End: Original strand, 46553353 - 46553397
Alignment:
| Q |
187 |
ttgccggtggtgggttggtggggatgaaggagagagatgatgatg |
231 |
Q |
| |
|
|||| |||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
46553353 |
ttgctggtggtgggttggtggggatgagggagagagatgatgatg |
46553397 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 176 - 221
Target Start/End: Original strand, 32548550 - 32548595
Alignment:
| Q |
176 |
ttttgatggtattgccggtggtgggttggtggggatgaaggagaga |
221 |
Q |
| |
|
|||||||||| |||| |||||||||||||| || |||||||||||| |
|
|
| T |
32548550 |
ttttgatggtgttgctggtggtgggttggttggtatgaaggagaga |
32548595 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 73; Significance: 2e-33; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 36 - 128
Target Start/End: Original strand, 31147305 - 31147400
Alignment:
| Q |
36 |
agtgtggcaagacaccaatcgaccaagttc-aaagttaccaggtacagtgaaagcttcttgccaccaaagtctg--caaactatttctgcttctta |
128 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |||||| |
|
|
| T |
31147305 |
agtgtggcaagacaccaatcgaccaagttctaaagttaccaggtacagtgaaagcttcttgccaccaaagtctgcacaaactatttctggttctta |
31147400 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 181 - 225
Target Start/End: Complemental strand, 38931480 - 38931436
Alignment:
| Q |
181 |
atggtattgccggtggtgggttggtggggatgaaggagagagatg |
225 |
Q |
| |
|
||||| |||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
38931480 |
atggtgttgctggtggtgggttggtggggatgaaggagagagatg |
38931436 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 126 - 164
Target Start/End: Original strand, 31147596 - 31147634
Alignment:
| Q |
126 |
ttagttggagtatgtaattttaataggttcacttccttg |
164 |
Q |
| |
|
|||| |||| ||||||||||||||||||||||||||||| |
|
|
| T |
31147596 |
ttagctggattatgtaattttaataggttcacttccttg |
31147634 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 37; Significance: 0.000000000005; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 181 - 225
Target Start/End: Complemental strand, 37562461 - 37562417
Alignment:
| Q |
181 |
atggtattgccggtggtgggttggtggggatgaaggagagagatg |
225 |
Q |
| |
|
||||| |||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
37562461 |
atggtgttgctggtggtgggttggtggggatgaaggagagagatg |
37562417 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 37; Significance: 0.000000000005; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 181 - 225
Target Start/End: Original strand, 51421557 - 51421601
Alignment:
| Q |
181 |
atggtattgccggtggtgggttggtggggatgaaggagagagatg |
225 |
Q |
| |
|
||||| |||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
51421557 |
atggtgttgctggtggtgggttggtggggatgaaggagagagatg |
51421601 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 168 - 219
Target Start/End: Original strand, 43079861 - 43079912
Alignment:
| Q |
168 |
gactatggttttgatggtattgccggtggtgggttggtggggatgaaggaga |
219 |
Q |
| |
|
|||| ||||||||||||| ||| |||||||||||||||||||||||||||| |
|
|
| T |
43079861 |
gactgtggttttgatggtgttggtggtggtgggttggtggggatgaaggaga |
43079912 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University