View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1751_low_12 (Length: 236)
Name: NF1751_low_12
Description: NF1751
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1751_low_12 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 88; Significance: 2e-42; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 88; E-Value: 2e-42
Query Start/End: Original strand, 12 - 143
Target Start/End: Complemental strand, 8628696 - 8628565
Alignment:
| Q |
12 |
ataagggtgagttgaaaatatggtttgatgactatgtcgtgatatcattttcacgattatactactatggttaaccataaaatttcatacactatgtttt |
111 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||| || |||||| || ||||||||||||||||||||||||||||| ||| | |
|
|
| T |
8628696 |
ataagggtgagtcgaaaatatggtttgatgactatgtcgtgatatcatttttacaattatattattatggttaaccataaaatttcatacactacgttgt |
8628597 |
T |
 |
| Q |
112 |
atgttttgtgttgattcgattgtgtaaaagat |
143 |
Q |
| |
|
|||||| | |||||||||||||||| ||||| |
|
|
| T |
8628596 |
gtgttttatattgattcgattgtgtagaagat |
8628565 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University