View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1751_low_14 (Length: 234)
Name: NF1751_low_14
Description: NF1751
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1751_low_14 |
 | |
|
| [»] scaffold0042 (1 HSPs) |
| | |
|
Alignment Details
Target: chr1 (Bit Score: 194; Significance: 1e-105; HSPs: 6)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 20 - 217
Target Start/End: Complemental strand, 14873367 - 14873170
Alignment:
| Q |
20 |
ctgtggtgagatcatatctagtggttgatattaaacatgctggttttagagaggttgatttcggttggggaaaaccttgttatggaggaccagctaaagg |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14873367 |
ctgtggtgagatcatatctagtggttgatattaaacatgctggttttagagaggttgatttcggttggggaaaaccttgttatggaggaccagctaaagg |
14873268 |
T |
|
| Q |
120 |
aggagttgtttctagttcgtatataccttttaaaaatgctaaaggaatagaaggtttggttataccagtttgtttgccaactaaagccatggagaggt |
217 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14873267 |
aggagttgtttctagttcgtatataccatttaaaaatgctaaaggaatagaaggtttggttataccagtttgtttgccaactaaagccatggagaggt |
14873170 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 139 - 214
Target Start/End: Complemental strand, 14767041 - 14766966
Alignment:
| Q |
139 |
tatataccttttaaaaatgctaaaggaatagaaggtttggttataccagtttgtttgccaactaaagccatggaga |
214 |
Q |
| |
|
||||||||||| ||||||||||||||| |||||||||||||||||| ||||||| ||| || |||||||||||| |
|
|
| T |
14767041 |
tatatacctttcaaaaatgctaaaggagaggaaggtttggttataccactttgtttaccagctcaagccatggaga |
14766966 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 140 - 217
Target Start/End: Complemental strand, 14786123 - 14786046
Alignment:
| Q |
140 |
atataccttttaaaaatgctaaaggaatagaaggtttggttataccagtttgtttgccaactaaagccatggagaggt |
217 |
Q |
| |
|
|||||||||| ||||||||||||||| |||||||||||||||||| ||| ||| |||| | ||| ||||||||||| |
|
|
| T |
14786123 |
atatacctttcaaaaatgctaaaggagaggaaggtttggttataccattttattttccaaatcaagtcatggagaggt |
14786046 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 170 - 217
Target Start/End: Complemental strand, 14877948 - 14877901
Alignment:
| Q |
170 |
aaggtttggttataccagtttgtttgccaactaaagccatggagaggt |
217 |
Q |
| |
|
||||||||||||||||||||| |||||||||| ||| ||||||||||| |
|
|
| T |
14877948 |
aaggtttggttataccagtttttttgccaactcaagtcatggagaggt |
14877901 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 140 - 217
Target Start/End: Original strand, 14759762 - 14759839
Alignment:
| Q |
140 |
atataccttttaaaaatgctaaaggaatagaaggtttggttataccagtttgtttgccaactaaagccatggagaggt |
217 |
Q |
| |
|
|||||||||| ||||||||||||||| |||||||||||||||||| ||| ||||| || ||| ||||||||||| |
|
|
| T |
14759762 |
atatacctttcaaaaatgctaaaggagaagaaggtttggttataccgtttttcttgcctgctcaagtcatggagaggt |
14759839 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #6
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 58 - 122
Target Start/End: Complemental strand, 14878075 - 14878011
Alignment:
| Q |
58 |
gctggttttagagaggttgatttcggttggggaaaaccttgttatggaggaccagctaaaggagg |
122 |
Q |
| |
|
||||| ||| |||| |||||||| |||||||| ||| || |||||||||||||||||||||||| |
|
|
| T |
14878075 |
gctggatttcgagatgttgattttggttgggggaaagctgtttatggaggaccagctaaaggagg |
14878011 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0042 (Bit Score: 43; Significance: 0.000000000000001; HSPs: 1)
Name: scaffold0042
Description:
Target: scaffold0042; HSP #1
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 139 - 217
Target Start/End: Complemental strand, 84039 - 83961
Alignment:
| Q |
139 |
tatataccttttaaaaatgctaaaggaatagaaggtttggttataccagtttgtttgccaactaaagccatggagaggt |
217 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||| ||||||||||||| ||| |||||| ||| ||| ||||||| |
|
|
| T |
84039 |
tatataccttttaaaaatgctaaaggagaggaaggttttgttataccagttttttttccaactcaagtcatcgagaggt |
83961 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 57 - 124
Target Start/End: Complemental strand, 11999728 - 11999661
Alignment:
| Q |
57 |
tgctggttttagagaggttgatttcggttggggaaaaccttgttatggaggaccagctaaaggaggag |
124 |
Q |
| |
|
|||||| |||||||| ||||| || |||||||| |||||| ||||||||||||||||||||||||| |
|
|
| T |
11999728 |
tgctggatttagagatgttgagtttggttgggggaaacctgtgtatggaggaccagctaaaggaggag |
11999661 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University