View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1751_low_16 (Length: 210)
Name: NF1751_low_16
Description: NF1751
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1751_low_16 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 173; Significance: 3e-93; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 173; E-Value: 3e-93
Query Start/End: Original strand, 15 - 195
Target Start/End: Complemental strand, 53811109 - 53810930
Alignment:
| Q |
15 |
gagagagagtcttgagatacttgagtgaaacttcaaacagttgagtgcaaggtttgtggtttcaactcaatggattaacagctttgggtattcaaaatat |
114 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
53811109 |
gagagagagtcttgagatacttgagtgaaacttcaaacagttgagtgcaaggtttgtggtttcaactcaatggatta-cagctttgggtattcaaaatat |
53811011 |
T |
 |
| Q |
115 |
tgtctatgaagtagattgtaagcaagtatagttgatacttgatggtatgatcaatgttaatctaattgaacggactatgtg |
195 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53811010 |
tgtctatgaagtagattgtaagcaagtatagttgatacttgatggtatgatcaatgttaatctaattgaacggactatgtg |
53810930 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University