View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1751_low_6 (Length: 284)
Name: NF1751_low_6
Description: NF1751
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1751_low_6 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 64; Significance: 5e-28; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 64; E-Value: 5e-28
Query Start/End: Original strand, 190 - 269
Target Start/End: Complemental strand, 37221273 - 37221194
Alignment:
| Q |
190 |
cttttctatgataattttctgagcaaagagaattgttccatggagaaaacacagtaaccgcgttcacaaagctttgtttt |
269 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||| |
|
|
| T |
37221273 |
cttttctatgataattttctgagcaaagagaattgttccatggagaaaacacaataacattgttcacaaagctttgtttt |
37221194 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 71 - 140
Target Start/End: Complemental strand, 37221389 - 37221320
Alignment:
| Q |
71 |
acccatctggaaaaaacttgaacacaaaacgaaacgacgtcgttttgtttgttactcttcaatgaaataa |
140 |
Q |
| |
|
|||||| || |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
37221389 |
acccatttgaaaaaaacttgaacacaaaacgaaacggcgtcgttttgtttgttactcttcaatgaaataa |
37221320 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 19 - 52
Target Start/End: Complemental strand, 37221422 - 37221389
Alignment:
| Q |
19 |
atctatccctcccacgcccagattcgtggcaaaa |
52 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
37221422 |
atctatccctcccacgcccagattcgtggcaaaa |
37221389 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 51; Significance: 3e-20; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 198 - 268
Target Start/End: Original strand, 37572190 - 37572260
Alignment:
| Q |
198 |
tgataattttctgagcaaagagaattgttccatggagaaaacacagtaaccgcgttcacaaagctttgttt |
268 |
Q |
| |
|
||||||||| | |||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
37572190 |
tgataatttcttcagcagagagaattgttccatggagaaaacacagtaacctcgttcacaaagctttgttt |
37572260 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University