View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1751_low_7 (Length: 260)
Name: NF1751_low_7
Description: NF1751
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1751_low_7 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 16 - 254
Target Start/End: Complemental strand, 31789943 - 31789704
Alignment:
| Q |
16 |
ctgatgagtaatccccctccttcagatgcaattccatttattgacttccttggagtaggagccacatgatcaaagttataaactaatcaaaaagctgcaa |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31789943 |
ctgatgagtaatccccctccttcagatgcaattccatttattgacttccttggagtaggagccacatgatcaaagttataaactaatcaaaaagctgcaa |
31789844 |
T |
|
| Q |
116 |
tgcaacccnnnnnnnnc-ccattgaagctcctcaatataggtgtggtccaacattacctaaaaaccattcgaggtaaacagaaaggatagttgctctact |
214 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31789843 |
tgcaacccttttttttttccattgaagctcctcaatataggtgtggtccaacattacctaaaaaccattcgaggtaaacagaaaggatagttgctctact |
31789744 |
T |
|
| Q |
215 |
ttggtcactgtgttacttgcgtcatttctgttcatctcac |
254 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
31789743 |
ttggtcactgtgttacttgcgtcatttctgttcatatcac |
31789704 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University