View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17520_high_14 (Length: 291)
Name: NF17520_high_14
Description: NF17520
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17520_high_14 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 94; Significance: 6e-46; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 94; E-Value: 6e-46
Query Start/End: Original strand, 52 - 157
Target Start/End: Complemental strand, 31016817 - 31016712
Alignment:
| Q |
52 |
tggtggtactagtcaacaatggttggaatcaataggcaaatcggatgctaaatttgtaatcttcctacaatgtgtttgaaattccatttgctgcttcttc |
151 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||| |||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31016817 |
tggtggtactagtcaacaatggttggaaacaataggcaaatcggatgctcaatttgtaatctgcctacaatgtgtttgaaattccatttgctgcttcttc |
31016718 |
T |
|
| Q |
152 |
atctga |
157 |
Q |
| |
|
|||||| |
|
|
| T |
31016717 |
atctga |
31016712 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 11 - 53
Target Start/End: Complemental strand, 31016949 - 31016907
Alignment:
| Q |
11 |
cacagaaattcatcttcacagaagcgcaagtttttggcaattg |
53 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
31016949 |
cacagaaattcatcttcacaaaagcgcaagtttttggcaattg |
31016907 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 53 - 112
Target Start/End: Complemental strand, 31026823 - 31026765
Alignment:
| Q |
53 |
ggtggtactagtcaacaatggttggaatcaataggcaaatcggatgctaaatttgtaatc |
112 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||| |||||||| || |||||| |||| |
|
|
| T |
31026823 |
ggtggtactggtcaacaatggttggaatcaataggc-aatcggatcctcaatttggaatc |
31026765 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University