View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17520_low_17 (Length: 256)
Name: NF17520_low_17
Description: NF17520
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17520_low_17 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 35 - 244
Target Start/End: Complemental strand, 4764424 - 4764215
Alignment:
| Q |
35 |
aatctcaaaatgggtgcccaatcccacatttttaatgatcccacgtgtgatgacaaatcagtgttcaggttttgccaggatatataatccatgtgccact |
134 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4764424 |
aatctcaaaatgggtgcccaatcccacatttttaatgatcccacgtgtgatgaaaaatcagtgttcaggttttgccaggatatataatccatgtgccact |
4764325 |
T |
|
| Q |
135 |
ataaattgatgcgaaggtgactcataataaccacaaagttataatccgtgaaccttgatctactttcatgtgatttgttaaacacatcagcattttgttt |
234 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4764324 |
ataaattgatgtgaaggtgactcataataaccacaaagttataatccgtgaaccttgatctactttcatgtgatttgttaaacacatcagcattttgttt |
4764225 |
T |
|
| Q |
235 |
ttatgaaaca |
244 |
Q |
| |
|
||||| |||| |
|
|
| T |
4764224 |
ttatggaaca |
4764215 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University