View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17521_low_24 (Length: 217)
Name: NF17521_low_24
Description: NF17521
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17521_low_24 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 178; Significance: 3e-96; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 178; E-Value: 3e-96
Query Start/End: Original strand, 18 - 199
Target Start/End: Complemental strand, 1034615 - 1034434
Alignment:
| Q |
18 |
ttcttcagttgctttgagctggtttttctggttggttgatcagaatcatgaagttgaggagaaaatattagaagaaatttgcagggtggtggatatcaag |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1034615 |
ttcttcagttgctttgagctggtttttctggttggttgatcagaatcatgaagttgaggagaaaatattagaagaaatttgcagggtggtggatatcaag |
1034516 |
T |
 |
| Q |
118 |
aaggatgagtttgatgattgtttgagatttaggtcagaggagattaagaagatggattatttgcatgctgctctttcagaag |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1034515 |
aaggatgagtttgatgattgtttgagatttaggtcacaggagattaagaagatggattatttgcatgctgctctttcagaag |
1034434 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 97; Significance: 8e-48; HSPs: 4)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 97; E-Value: 8e-48
Query Start/End: Original strand, 18 - 199
Target Start/End: Complemental strand, 13897558 - 13897365
Alignment:
| Q |
18 |
ttcttcagttgctttgagctggtttttctggttggttgatcagaatcatgaagttgaggagaaaatattagaagaaatttgcagggt------------g |
105 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| | |
|
|
| T |
13897558 |
ttcttcagttgctttaagctggtttttctggttggttgatcagaatcatgaagttgaggagaaaatattagaagagatttgcagggttgtgtgtcaaagg |
13897459 |
T |
 |
| Q |
106 |
gtggatatcaagaaggatgagtttgatgattgtttgagatttaggtcagaggagattaagaagatggattatttgcatgctgctctttcagaag |
199 |
Q |
| |
|
| |||||| || ||||| | |||| |||||| ||||||||| | | | |||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
13897458 |
gaggatattaataaggaagtgtttaatgattctttgagattcaagcctgaggagattaagaagatggattatttgcatgcagctctttcagaag |
13897365 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 63; E-Value: 1e-27
Query Start/End: Original strand, 18 - 104
Target Start/End: Original strand, 13887652 - 13887738
Alignment:
| Q |
18 |
ttcttcagttgctttgagctggtttttctggttggttgatcagaatcatgaagttgaggagaaaatattagaagaaatttgcagggt |
104 |
Q |
| |
|
||||||||||||||| ||||||||||||||||| || |||||||||||||||| |||||||||||||||||||| ||||||||||| |
|
|
| T |
13887652 |
ttcttcagttgctttaagctggtttttctggttacttaatcagaatcatgaagtggaggagaaaatattagaagagatttgcagggt |
13887738 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 154 - 198
Target Start/End: Original strand, 13887806 - 13887850
Alignment:
| Q |
154 |
gaggagattaagaagatggattatttgcatgctgctctttcagaa |
198 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
13887806 |
gaggagattaagaagatgggttatttgcatgctgctctttcagaa |
13887850 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 18 - 108
Target Start/End: Complemental strand, 7295589 - 7295502
Alignment:
| Q |
18 |
ttcttcagttgctttgagctggtttttctggttggttgatcagaatcatgaagttgaggagaaaatattagaagaaatttgcagggtggtg |
108 |
Q |
| |
|
||||| |||||||||||| || ||||||||||| ||||||| ||| ||||| | ||||| |||| ||| ||| ||||||||||||||| |
|
|
| T |
7295589 |
ttctttagttgctttgaggcggcttttctggttgcttgatcataataatgaaatggaggaaaaaa---tagtagagatttgcagggtggtg |
7295502 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 47; Significance: 5e-18; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 18 - 108
Target Start/End: Complemental strand, 28666895 - 28666805
Alignment:
| Q |
18 |
ttcttcagttgctttgagctggtttttctggttggttgatcagaatcatgaagttgaggagaaaatattagaagaaatttgcagggtggtg |
108 |
Q |
| |
|
|||||| || |||||||| |||||||| ||||| ||||||||||||||||||| |||||||| ||||||||||| || |||| ||||||| |
|
|
| T |
28666895 |
ttcttctgtggctttgagttggtttttttggttacttgatcagaatcatgaagtggaggagaagatattagaagagatatgcaaggtggtg |
28666805 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University