View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17522_high_21 (Length: 316)
Name: NF17522_high_21
Description: NF17522
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17522_high_21 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 248; Significance: 1e-138; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 248; E-Value: 1e-138
Query Start/End: Original strand, 65 - 316
Target Start/End: Original strand, 8187863 - 8188114
Alignment:
| Q |
65 |
tgcagactttaatcctttgtttctaaaggaaacactttcggatgcttcatcaagtttgagttctgaaggtgatggattggatcgtaatgttgtagatagt |
164 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8187863 |
tgcagactttaatcctttgtttctaaaggaaacactttcagatgcttcatcaagtttgagttctgaaggtgatggattggatcgtaatgttgtagatagt |
8187962 |
T |
|
| Q |
165 |
gggccatctatggatatagatttggaaaagataacggataatgagcaaatctgtagtgcagtagattctgaacatggcgaggaggaaattgttttagaag |
264 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8187963 |
gggccatctatggatatagatttggaaaagataacggataatgagcaaatctgtagtgcagtagattctgaacatggcgaggaggaaattgttttagaag |
8188062 |
T |
|
| Q |
265 |
cggcaggtatgatatctcaattggagattgataaggagaagaagaatgactt |
316 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8188063 |
cggcaggtatgatatctcaattggagattgataaggagaagaagaatgactt |
8188114 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University