View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17522_high_9 (Length: 363)
Name: NF17522_high_9
Description: NF17522
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17522_high_9 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 319; Significance: 1e-180; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 319; E-Value: 1e-180
Query Start/End: Original strand, 21 - 343
Target Start/End: Original strand, 29100592 - 29100914
Alignment:
| Q |
21 |
acatcatcacatgagtctccatctggaatcaggtcattcaggaaaatagaatctctaaagattggtcaaaaggtaaccttaattggcccttcatttctaa |
120 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29100592 |
acatcgtcacatgagtctccatctggaatcaggtcattcaggaaaatagaatctctaaagattggtcaaaaggtaaccttaattggcccttcatttctaa |
29100691 |
T |
|
| Q |
121 |
tcctaaagttttaaatgaaatgtgttttatctgtttgataagcctttatttttgcttcacagattgtcagagatagcaaggatgattcggggcggttctc |
220 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29100692 |
tcctaaagttttaaatgaaatgtgttttatctgtttgataagcctttatttttgcttcacagattgtcagagatagcaaggatgattcggggcggttctc |
29100791 |
T |
|
| Q |
221 |
tggattgttatcttctagtgactcaccacgcattggagcttcgagaacatcaagtagtagattatcttttcaggatgacttggatgatggtgacttttcg |
320 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29100792 |
tggattgttatcttctagtgactcaccacgcattggagcttcgagaacatcaagtagtagattatcttttcaggatgacttggatgatggtgacttttcg |
29100891 |
T |
|
| Q |
321 |
tgtccttttgatgttgatgatgt |
343 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
29100892 |
tgtccttttgatgttgatgatgt |
29100914 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University