View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17523_high_21 (Length: 321)
Name: NF17523_high_21
Description: NF17523
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17523_high_21 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 281; Significance: 1e-157; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 281; E-Value: 1e-157
Query Start/End: Original strand, 16 - 304
Target Start/End: Original strand, 43716929 - 43717217
Alignment:
| Q |
16 |
atcaggtgctgagccctacaagcctaaaagatctgaagcttcgtcgtattcttcatcttcggtgaccccggctcagttattgcttctgcaatcaaattca |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43716929 |
atcaggtgctgagccctacaagcctaaaagatctgaagcttcgtcgtattcttcatcttcggtgaccccggctcagttattgcttctgcaatcaaattca |
43717028 |
T |
 |
| Q |
116 |
cattcctcatcaattgcttattcttcatcctcaaccgcagcagtctaccactcaccaaggaaccaatcatgaattctagattgattaaagctattgattg |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||| |
|
|
| T |
43717029 |
cattcctcatcaattgcttattcttcatcctcaaccgcagcagtctaccactcaccaaggaaccaatcatgaattctatattgattgaagctattgattg |
43717128 |
T |
 |
| Q |
216 |
ctgtatttcaggacatagataagatcttgttattagatttattctgattgattagttaattagttgcagtaattaaccgttagtgtaat |
304 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43717129 |
ctgtatttcaggacatagataagatcttgttattagatttattctgattgattagttaattagttgcagtaattaaccgttagtgtaat |
43717217 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University