View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17523_high_26 (Length: 297)
Name: NF17523_high_26
Description: NF17523
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17523_high_26 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 108; Significance: 3e-54; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 108; E-Value: 3e-54
Query Start/End: Original strand, 15 - 134
Target Start/End: Complemental strand, 14050227 - 14050108
Alignment:
| Q |
15 |
agaaaaaacacaaatatccacatagctaattcgtgaataaattacctagttgtttttcttccaaatgtcatttatcacaagaaagaatgacggtaataga |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |||| ||| |
|
|
| T |
14050227 |
agaaaaaacacaaatatccacatagctaattcgtgaataaattacccagttgtttttcttccaaatgtcatttatcacaagaaagaatgacagtaagaga |
14050128 |
T |
 |
| Q |
115 |
tcaaataaatgtagcaccac |
134 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
14050127 |
tcaaataaatgtagcaccac |
14050108 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University