View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17523_high_47 (Length: 201)
Name: NF17523_high_47
Description: NF17523
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17523_high_47 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 108; Significance: 2e-54; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 108; E-Value: 2e-54
Query Start/End: Original strand, 1 - 119
Target Start/End: Complemental strand, 45242118 - 45242002
Alignment:
| Q |
1 |
cttgatcaattatctgttcttttttgtggcccaagaattattgaaatcctaagtatataaaatatgattttgttgactttcttatggctttagaactttc |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45242118 |
cttgatcaattatctgttcttttttgtggcccaagaattattgaaatcctaagtata--aaatatgattttgttgactttcttatggctttagaactttc |
45242021 |
T |
 |
| Q |
101 |
aaagttagagatttgcttg |
119 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
45242020 |
aaagttagagatttgcttg |
45242002 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 112 - 189
Target Start/End: Complemental strand, 45241952 - 45241875
Alignment:
| Q |
112 |
tttgcttgctcttaataattcttatgtttccctatatcttagtaaatttcttcaatataggatgaagtctagtatttt |
189 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45241952 |
tttgcttgctcttaataattcttatgtttccctatatcttagtaaatttcttcaatataggatgaagtctagtatttt |
45241875 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University