View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17523_low_25 (Length: 308)
Name: NF17523_low_25
Description: NF17523
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17523_low_25 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 20 - 297
Target Start/End: Complemental strand, 39526322 - 39526062
Alignment:
| Q |
20 |
tatagaaaccagtgcaaaagcaggatttaatatcaaggtgaaatttgattaattctccgagtcaccccatattttcatgtatcatgcttttgaattctga |
119 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39526322 |
tatagaaactagtgcaaaagcaggatttaatatcaaggtgaaatttgattaattctccaagtcaccccatattttcatgtatcatgcttttgaattctga |
39526223 |
T |
 |
| Q |
120 |
agtctgtcttctaaacatatatccatctgagaaaccttgaatgattctcagctgcattttcattaaatgtaaaagtatgccacttatggatttcaaactt |
219 |
Q |
| |
|
|||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
39526222 |
agtctgtcttctaaac--atatcaatctgagaaaccttgaatgattctcagctgcattttcattaaatgtaaaagtatgcc---------------actt |
39526140 |
T |
 |
| Q |
220 |
gtggtcaactgtctttcttttttacatgtttgtctcattctatatgttttgctctcgccgtcactttatcgtgttcat |
297 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39526139 |
gtggtcaactgtctttcttttttacatgtttgtctcattctatatgttttgctctcgccgtcactttatcgtgttcat |
39526062 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University