View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17523_low_29 (Length: 289)
Name: NF17523_low_29
Description: NF17523
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17523_low_29 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 243; Significance: 1e-135; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 243; E-Value: 1e-135
Query Start/End: Original strand, 7 - 273
Target Start/End: Original strand, 41752401 - 41752667
Alignment:
| Q |
7 |
tccaagaatatgagttgttgctgaatttacagatacagatacaatgcaaccaatcatggtaaatatgaggatactaaggtgcattttctcggccattgtc |
106 |
Q |
| |
|
||||| ||| ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41752401 |
tccaacaatgtgagttgttgctgaatttacagatacaaatacaatgcaaccaatcatggtaaatatgaggatactaaggtgcattttctcggccattgtc |
41752500 |
T |
|
| Q |
107 |
ttccctagttatgtttctactgactgtcttattccttaacttgtgatgttattgtttatagattaaatgagaagatgggaacgaattgaagtcactcttt |
206 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
41752501 |
ttccctagttatgtttctactgactgtcttattccttaacttgtgatgttattgtttgtagattaaatgagaagatgggaatgaattgaagtcactcttt |
41752600 |
T |
|
| Q |
207 |
taatagtgctcatcacacaaaaattggcatttccccttcaactttaaggatttgaattagtcaaacc |
273 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41752601 |
taatagtgatcatcacacaaaaattggcatttccccttcaactttaaggatttgaattagtcaaacc |
41752667 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University